View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13245_high_40 (Length: 203)
Name: NF13245_high_40
Description: NF13245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13245_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 3570048 - 3569873
Alignment:
| Q |
17 |
tttttgtggtttgattctattgtatatttcttttatggggtggtttggtttgattgtaactggcacagaagtgaagtaaacgtctcatacgctatccaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3570048 |
tttttgtggtttgattctattgtatatttattttatggggtggtttggtttgattgtaactggcacagaagtgaagtaaacgtctcacatgctatccaat |
3569949 |
T |
 |
| Q |
117 |
tgtcatcttggacctaccaaagcaagatcctcaaacattccatcaagctttgcctctaattatggaatattcttcg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3569948 |
tgtcatcttggacctaccaaagcaagatcctcaaacattccatcaagctttgcctctaattatggaatattgttcg |
3569873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University