View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13245_low_31 (Length: 253)
Name: NF13245_low_31
Description: NF13245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13245_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 52809428 - 52809239
Alignment:
| Q |
15 |
caaagggcacatggataggtttttctttcttctagcagggctagttgtttttgattttgtgatttacttgttctgtgctaagtggtacaagagtatcaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809428 |
caaagggcacatggataggtttttctttcttctagcagggctagttgtttttgattttgtgatttacttgttctgtgctaagtggtacaagagtatcaat |
52809329 |
T |
|
| Q |
115 |
gttcaaggtgaccaagaggagttggatgatgatgttgctcaag---ttataattaagtcggcatccaaagaccaacctttaacaccacaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809328 |
gttcaaggtgaccaagaggagttggatgatgatgatgctcaagttattataattaagtcggcatccaaagaccaacctttaacaccacaa |
52809239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University