View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13245_low_37 (Length: 235)
Name: NF13245_low_37
Description: NF13245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13245_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 13772030 - 13772246
Alignment:
| Q |
5 |
aagaaccagaataataagatttgcaatgatgtcttcgaaaattgtcaagcaatttgtcatagagccacaacgttgttagctagctgggagaatgctcaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13772030 |
aagaaccagaataataagatttgcaatgatgtcttcgaaaattgtcaagcaatttgtcatagagccacaacgttgttagctagctgggagaatgctcaag |
13772129 |
T |
 |
| Q |
105 |
gttggaaagcatcggcaccaattcctcaatatggattttgagatagactcaaaaacggtcgtggataacatctacggaaagcagattgttgtatctgatt |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
13772130 |
gttggaaaacatcggcaccaattcctcaatatggattttgagatagactcataaacggtcgtggatgacatctacggaaagcagattgttgtatctaatt |
13772229 |
T |
 |
| Q |
205 |
ttagtgttataattagt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13772230 |
ttagtgttataattagt |
13772246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 6770715 - 6770771
Alignment:
| Q |
65 |
agagccacaacgttgttagctagctgggagaatgctcaaggttggaaagcatcggca |
121 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| || |||| || ||||| |
|
|
| T |
6770715 |
agagccacaacactgttagctagttgggagaatgctcaagatttgaaaacaacggca |
6770771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University