View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13246_low_5 (Length: 422)
Name: NF13246_low_5
Description: NF13246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13246_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 5 - 404
Target Start/End: Original strand, 27740187 - 27740586
Alignment:
| Q |
5 |
atcaatcgagttcccttccacaagtccaagcttccctaaaacaacttgcaattccttagctgatatgtaaccatcaccatcttcatcaaacaccttgaat |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27740187 |
atcaatcaagttcccttccacaagtccaagcttccctaaaacaacttgcaattccttagctgatatgtaaccatcaccatcttcatcaaacaccttgaat |
27740286 |
T |
|
| Q |
105 |
gcttcccatagatcttcattttgtgtttcctcatcagtttctgctgccactgaaaaatatgtatcccccagtgactcgtgcaatcccacgaaatcttcgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27740287 |
gcttcccatagatcttcattttgtgtttcctcatcagtttctgctgccactgaaaaatatgtatcccccagtgactcgtgcaatcccacgaaatcttcgt |
27740386 |
T |
|
| Q |
205 |
acgttagtcctacgttgcccggctttatgtatgacctgccacaatttttatcagtatattttcaatttcaaactctagttaatactgaggtctctttaac |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27740387 |
acgttagtcctacgttgcccggctttatgtatgacctgccacaatttttatcagtatattttcaatttcaaactctagttaatactgaggtctctttaac |
27740486 |
T |
|
| Q |
305 |
gacatcatggtcgcagtcaaccacttttttacagcgatataaggcccatagcataattatgacagctatttataatcatggcagtcgtaatagttgttac |
404 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27740487 |
gacatcatggtcgcattcaaccacttttttacagcgatataaggcccatagcataattatgacagctatttataatcatggcagtcgtaatagttgttac |
27740586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University