View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13248_high_14 (Length: 241)
Name: NF13248_high_14
Description: NF13248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13248_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41771800 - 41772022
Alignment:
| Q |
1 |
ttttacatttggtaatatagaaatactatatgtaaaaaggaacgcttcagccagctactacagttgttcatcaagcttatatcaatggatcaacaaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41771800 |
ttttacatttggtaatatagaaatactatatgtaaaaaggaacgcttcagccagctactacagttgttcatcaagcttatatcaatggatccacaaatat |
41771899 |
T |
 |
| Q |
101 |
gataatttgcatcaaacaccagcccctggccgcggctgaagcatggaagaaatcagattttagtttcatcaaatgtaactcaggttttatacatcttata |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41771900 |
gatcatttgcatcaaacaccagcccctggccgcggctgaagcatggaagaaatcagattttagtttcatcaaatgtaactcaggttttatagctcttata |
41771999 |
T |
 |
| Q |
201 |
tatagtgcctcccaaatcacaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41772000 |
tatagtgcctcccaaatcacaat |
41772022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University