View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13248_high_8 (Length: 289)
Name: NF13248_high_8
Description: NF13248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13248_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 28102490 - 28102642
Alignment:
| Q |
19 |
caagtcaatgattttcatctcggaacgcagcctcacgtggatcactatctggcggcttaggtgacgatcgaggataacaagatgaattgttagaaccctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28102490 |
caagtcaatgattttcatctcggaacgcagcctcacgtggatcactatctggcgggttaggtgacgatcgaggataacgagatgaattgttagaaccctt |
28102589 |
T |
 |
| Q |
119 |
gataaaattgaattttccatacgattaaaccttcaattgggtttttatcaaac |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102590 |
gataaaattgaattttccatacgattaaaccttcaattgggtttttatcaaac |
28102642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 28102712 - 28102749
Alignment:
| Q |
241 |
aaaagagttaagggatagagagaaagaacacagagatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102712 |
aaaagagttaagggatagagagaaagaacacagagatt |
28102749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University