View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13248_low_6 (Length: 352)
Name: NF13248_low_6
Description: NF13248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13248_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 19 - 340
Target Start/End: Original strand, 44829016 - 44829337
Alignment:
| Q |
19 |
atgtttcaccttcctgatgattataatatacatttctttttctagaaactgcctgatctgcagtcattttttcatttctattttgcaagaaatgttttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829016 |
atgtttcaccttcctgatgattataatatacatttctttttctagaaactgcctgatctgcagtcattttttcatttctattttgcaagaaatgttttca |
44829115 |
T |
|
| Q |
119 |
aaaagtagtaaatagacgacacaaatttaacatagattgatcaataacatttgacatcaaatgcatattaaacatacactttcacttcctaaaaattttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829116 |
gaaagtagtaaatagacgacacaaatttaacatagattgatcaataacatttgacatcaaatgcatattaaacatacactttcacttcctaaaaattttc |
44829215 |
T |
|
| Q |
219 |
atgtaataggattcacaacatgtcattgaaatttataagtcaaacacacctggctaaatgtatccaagacgtatatggaggtaacctgttgatgcttggc |
318 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829216 |
atgtaagaggattcacaacatgtcattgaaatttataattcaaacacacctggctaaatgtatccaagacgtatatggaggtaacctgttgatgcttggc |
44829315 |
T |
|
| Q |
319 |
atcctgatagttctcacaggtt |
340 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44829316 |
atcctgatagttctcacaggtt |
44829337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University