View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13249_high_11 (Length: 284)
Name: NF13249_high_11
Description: NF13249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13249_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 4861531 - 4861782
Alignment:
| Q |
20 |
tatccgtgcgtcttctcaatttttaattatatgcaatttgtaattaagaaaatgtaaattccatccctattcatatctatgatgtatcaaaactatagta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4861531 |
tatccgtgcgtcttctcaatttttaattatatgcaatttgtcattaagaaaatgtaaattccatccctattcatatctatgatgtatcaaaactatagta |
4861630 |
T |
|
| Q |
120 |
acaa-ccacgtacgtacgtacgtacacgaaacaaattcagaagtgggtctataaccttggtacgtatggctaggaaattaaaaagaagatgccaaatatc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4861631 |
acaaaccacgtacgtacgtacgtacacgaaacaaattcagaagtgggtctataaccttggtacgtatggctaggaaattaaaaagaagatgccaaatatc |
4861730 |
T |
|
| Q |
219 |
atacactgacaaaataatctagcaatcccctttgctcacttatctgtgctcc |
270 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
4861731 |
atgcactgacaaaataatctatcaatcccctttgctcacttatttgtgctcc |
4861782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University