View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_high_19 (Length: 274)
Name: NF1324_high_19
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 93 - 266
Target Start/End: Complemental strand, 1708999 - 1708826
Alignment:
| Q |
93 |
gtttggatgagtttgtagttgacagagaaggagaggaaggtggtggttttgtcaacggcggtggtggtgaagagggaagagattagggttcggaggagtg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1708999 |
gtttggatgagtttgtagttgacagagaaggagaggaaggtggtggttttgtcaacggcggtggtggtgaagagggaagagattagggttcggaagagtg |
1708900 |
T |
|
| Q |
193 |
gtggaagtggtagtggtatggcgccgccgtccatgtttttcgcgttcttccccatttttgttatttttcttttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1708899 |
gtggaagtggtagtggtatggcgccgccgtccatgtttttcgcgttcttccccatttttgttatttttcttttc |
1708826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University