View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1324_high_3 (Length: 618)

Name: NF1324_high_3
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1324_high_3
NF1324_high_3
[»] chr4 (2 HSPs)
chr4 (33-96)||(48868427-48868490)
chr4 (486-522)||(48882026-48882062)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 48868427 - 48868490
Alignment:
33 taagcaacgcaagaataattgaaatgattgtaggtgacaaatggtcaccgtggtctacgttata 96  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48868427 taagcaacacaagaataattgaaatgattgtaggtgacaaatggtcaccgtggtctacgttata 48868490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 486 - 522
Target Start/End: Original strand, 48882026 - 48882062
Alignment:
486 atggttcaattggttgttgatcttcagctaaatgaat 522  Q
    ||||||||||| |||||||||||||||||||||||||    
48882026 atggttcaattagttgttgatcttcagctaaatgaat 48882062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University