View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_18 (Length: 304)
Name: NF1324_low_18
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 141 - 289
Target Start/End: Original strand, 31603397 - 31603542
Alignment:
| Q |
141 |
tgagatgtataagaaaatggaacgaagaatcattggtcaaagcacaatagaaaaggatgctactcaggtcagccctgagactttgagtgtcatgggaaaa |
240 |
Q |
| |
|
|||| ||||||||||||| ||||| ||| ||||||||| |||||| ||| || |||||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31603397 |
tgagttgtataagaaaatagaacggagattcattggtcggagcacagtaggaa-ggatgctacttaggtcagtcctgagact--gagtgtcatgggaaaa |
31603493 |
T |
|
| Q |
241 |
gtaataaaatgatgtcgttctaactatttgaatattattctccttacat |
289 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31603494 |
gtaattaaatgacgtcgttctaactatttgaatattattctccttacat |
31603542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 30 - 148
Target Start/End: Original strand, 31603237 - 31603355
Alignment:
| Q |
30 |
tatggatggcatcattacatgagcctttcagaatcagaggcgggtcaattaagccataacattcgcttgccacatggtggagacggggcaagagcagcat |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||| || ||||||| | | |||||||||||||||||||||||||||||||| || |
|
|
| T |
31603237 |
tatggatggcatcatcacatgagcctttcagaatcagaggcggttcaactaggccataatagttgcttgccacatggtggagacggggcaagagcaacaa |
31603336 |
T |
|
| Q |
130 |
atgttgtcctatgagatgt |
148 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
31603337 |
atgttgtcctataagatgt |
31603355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University