View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_19 (Length: 303)
Name: NF1324_low_19
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 104 - 238
Target Start/End: Original strand, 33442058 - 33442192
Alignment:
| Q |
104 |
ttcgcgagcgctcacacagtgattctactactctgtcccgtgatgtttctatgtgttgtatgaagggaaagataactttgccttatatgattgaacctcc |
203 |
Q |
| |
|
||||||||||||||| || || ||| ||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33442058 |
ttcgcgagcgctcacgtagggactcttctactttgtcccatgatgtttcaatgtgttgtatgaagggaaagataactttgccttatatgattgaacctcc |
33442157 |
T |
 |
| Q |
204 |
accctttctgcgtcaacttttcaatggtcttcatc |
238 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| |
|
|
| T |
33442158 |
tcccttgctccgtcaacttttcaatggtcttcatc |
33442192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University