View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_20 (Length: 302)
Name: NF1324_low_20
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 125 - 293
Target Start/End: Complemental strand, 1709360 - 1709192
Alignment:
| Q |
125 |
gccttctccttgatctctctccgcaaccttcacttccaactgccgcaacgccctcccaaacgctgaagacaaagcaacacggttaacctcacataacgaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1709360 |
gccttctccttgatctctctccgcaaccttcacttccaactgccccaacgccctcccaaacgctgaagacaaagcaacacggttaacctcacgtaacgaa |
1709261 |
T |
|
| Q |
225 |
tgaacaccgtcgaggtgattatcgtcgataatcttctcagttaacgatcgaaccacttcgtatattctt |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1709260 |
tgaacaccatcgaggtgattatcgtcgataatcttctcagttaacgatcgaacaacttcgtattttctt |
1709192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University