View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_21 (Length: 300)
Name: NF1324_low_21
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 57 - 246
Target Start/End: Complemental strand, 38286914 - 38286725
Alignment:
| Q |
57 |
tgaaaagaaaccgagaggcagtactaattaacaaccgaatgttgccaatctggatcccacggaaaaaatagatcaaatagattttctgtctcactttgtg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38286914 |
tgaaaagaaaccgagaggcagtactaattaacaaccgaatgttgccaatctggatcccacggaaaaaatagatcaaatagattttctgtttcactttgtg |
38286815 |
T |
 |
| Q |
157 |
aaagatttgaaaaggaagaaatcattatgtattcaaaaatttaaatttcaggccttttgtaacaacaatgttaacatagttcatatcagt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38286814 |
aaagatttgaaaaggaagaaatcattatgtattcaaaaatttaaatttcaggccttttgtaacaacaatgttaacatagttcatgtcagt |
38286725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University