View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_25 (Length: 283)
Name: NF1324_low_25
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 97 - 275
Target Start/End: Complemental strand, 10995307 - 10995129
Alignment:
| Q |
97 |
gacccccaaaatttggatgccctgtgcaatagggctgcttgcacttggccttagtcggcccttcttagaaacataaatgtccaataacataagcccaatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995307 |
gacccccaaaatttggatgccctgtgcaatagggctgcttgcacttggccttagtcggcccttcttagaaacataaatgtccaataacataagcccaatc |
10995208 |
T |
|
| Q |
197 |
ttattatctaacaaatgagacaacaatcactagaagatttagaaatcgctcttgaactagaatcagcctgcttcatctc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995207 |
ttattatctaacaaatgagacaacaatcactagaagatttagaaatcgctcttgaactagaatcagcctgcttcatctc |
10995129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 107 - 266
Target Start/End: Complemental strand, 11000692 - 11000533
Alignment:
| Q |
107 |
atttggatgccctgtgcaatagggctgcttgcacttggccttagtcggcccttcttagaaacataaatgtccaataacataagcccaatcttattatcta |
206 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000692 |
atttggaggccctgtgcagcagggctgcttgtacttggccttagtcggcccttcttagaaacataaatgtccaataacataagcccaatcttattatcta |
11000593 |
T |
|
| Q |
207 |
acaaatgagacaacaatcactagaagatttagaaatcgctcttgaactagaatcagcctg |
266 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11000592 |
acaaattagacaacaatcactagaagatttaaaaatcgctcttgaactagaatcagcctg |
11000533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 10995403 - 10995340
Alignment:
| Q |
1 |
taatgaaactatgatgaactccctcacaaagtgaaactaaatgtcaaaaacaatgatccttaaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995403 |
taatgaaactatgatgaactccctcacaaagtgaaactaaatgtcaaaaacaatgatccttaaa |
10995340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University