View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_26 (Length: 279)
Name: NF1324_low_26
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_26 |
 | |
|
| [»] scaffold0013 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 52 - 243
Target Start/End: Original strand, 5722352 - 5722543
Alignment:
| Q |
52 |
tagatcttgtatcaaaggatgtggatagtaaagatcttcctgcannnnnnnaacagtaataatatattataaagaggaaatgtgcacacacaaattgtgg |
151 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5722352 |
tagatcttgtatcaaaggatggggatagtaaagatcttcctgcatttttttaacggtaataatatattataaagaggaaatgtgcacacacaaattgtgg |
5722451 |
T |
|
| Q |
152 |
ttaatcaaagataatacccctcacctttgcacatagatggcgtactttttgccaattaactttttcataatgttctgtaaggagttcatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5722452 |
ttaatcaaagataatacccctcacctttgcacataggtgacgtactttttgccaattaactttttcataaggttctgtaaggagttcttctc |
5722543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 128 - 243
Target Start/End: Original strand, 5670314 - 5670429
Alignment:
| Q |
128 |
gaaatgtgcacacacaaattgtggttaatcaaagataatacccctcacctttgcacatagatggcgtactttttgccaattaactttttcataatgttct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5670314 |
gaaatgtgcacacacaaattgtggttaatcaaagataatacccctcacctttgcacatagatggcgtactttttgccaattaactttttcataatgttct |
5670413 |
T |
|
| Q |
228 |
gtaaggagttcatctc |
243 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
5670414 |
gtaaggagttcttctc |
5670429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 117 - 243
Target Start/End: Original strand, 5692077 - 5692203
Alignment:
| Q |
117 |
attataaagaggaaatgtgcacacacaaattgtggttaatcaaagataatacccctcacctttgcacatagatggcgtactttttgccaattaacttttt |
216 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5692077 |
attataaagaggatatgtaaacacacacattgtggttaatcagagataatactcctcacctttgcacatagatggcgtactttttgccaattaacttttt |
5692176 |
T |
|
| Q |
217 |
cataatgttctgtaaggagttcatctc |
243 |
Q |
| |
|
||||| |||||||||||||||| |||| |
|
|
| T |
5692177 |
cataaggttctgtaaggagttcttctc |
5692203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 48 - 132
Target Start/End: Original strand, 5670084 - 5670168
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctgcannnnnnnaacagtaataatatattataaagaggaaat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5670084 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctgcatttttttaacagtaataatatattataaagaggaaat |
5670168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 5691961 - 5692008
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctgca |
95 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5691961 |
atattagatcttgtatcaaaggatggggatagtaaagatcttcctgca |
5692008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 13052661 - 13052616
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctg |
93 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13052661 |
atatcagatcttgtatcaaaggatgaggatagtaaagatcttcctg |
13052616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 164718 - 164674
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcct |
92 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
164718 |
atatcagatcttgtatcaaaggatggggatagtaaagatcttcct |
164674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 103758 - 103713
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctg |
93 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
103758 |
atatcagatcttgtatcaaaggatggggatagtaaatatcttcctg |
103713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 92550 - 92595
Alignment:
| Q |
48 |
atattagatcttgtatcaaaggatgtggatagtaaagatcttcctg |
93 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
92550 |
atattaaatcttgtatcaaaggatgaggatagtagatatcttcctg |
92595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 92678 - 92722
Alignment:
| Q |
170 |
cctcacctttgcacatagatggcgtactttttgccaattaacttt |
214 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| ||| |||||||| |
|
|
| T |
92678 |
cctcacctttgcacataggtggcgtgcttttttccagttaacttt |
92722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University