View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_31 (Length: 255)
Name: NF1324_low_31
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 29 - 240
Target Start/End: Complemental strand, 26211995 - 26211784
Alignment:
| Q |
29 |
cactaggtactagaaagtgttttgcttgataaagaatacccttatacttttaataatatttatcttttggtaccaaagttcaattattgccactagccca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211995 |
cactaggtactagaaagtgttttgcttgataaagaatacccttatacttttaataatatttatcttttggtaccaaagttcaattattgccactagccca |
26211896 |
T |
 |
| Q |
129 |
tgacccatattagtcataattataaaatttatttggaatatttgnnnnnnnatcaagggaaaacaaagacaaaacaaaggaacaactacattctcaatga |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211895 |
tgacccatatcagtcataattataaaatttatttggaatatttgtttttttatcaagggaaaacaaagacaaaacaaaggaacaactacattctcaatga |
26211796 |
T |
 |
| Q |
229 |
caccctcttcat |
240 |
Q |
| |
|
||||||| |||| |
|
|
| T |
26211795 |
caccctcctcat |
26211784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University