View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_34 (Length: 253)
Name: NF1324_low_34
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 49 - 222
Target Start/End: Complemental strand, 3365912 - 3365739
Alignment:
| Q |
49 |
aagagtaatgattataattttgcagaagcctagaagtagaaggtaatgagtctcctaccagaaaggaaaaaa-gaacacaagagttgattggtttaaaag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
3365912 |
aagagtaatgattataattttgcagaagcctagaagtagaaggtaatgagtctcctaccagaaaggaaaaaaagaacacaaga-ttgattggtttaaaag |
3365814 |
T |
|
| Q |
148 |
taggcgggcacatcatgactgaccagctagctcctctaaatgtagcaacaagttctgtctgatttgagttctctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3365813 |
taggcgggcacatcatgactgaccagctagctcctctaaatgtagcaacaagttctgtctgatttgagttctctt |
3365739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University