View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_38 (Length: 248)
Name: NF1324_low_38
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 66 - 241
Target Start/End: Complemental strand, 29023091 - 29022912
Alignment:
| Q |
66 |
gtgtaattaagtcaaattaatatgatatccaaccacatacgatgacaaagagggaccataccctgtatggttgattcgtgcttgtcctagtcatcatgtc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29023091 |
gtgtaattaagtcaaattaatatgatatccaaccacatatgatgacaaagagggaccatatcctgtatggttaattcgtgcttgtcctagtcatcatgtc |
29022992 |
T |
 |
| Q |
166 |
atttatgtttccttacgttaatg----nnnnnnnngaacatgccaaaatgagatataacattagcaaatgtgtttcatct |
241 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29022991 |
atttatgttttcttacgtgaatgtttttttttttttaacatgccaaaatgagatataacattaacaaatgtgttccatct |
29022912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 29023118 - 29023080
Alignment:
| Q |
8 |
gagattattaaaatagaggaattaaaagtgtaattaagt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29023118 |
gagattattaaaatagaggaattaaaagtgtaattaagt |
29023080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University