View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_39 (Length: 248)
Name: NF1324_low_39
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 22042591 - 22042728
Alignment:
| Q |
21 |
atttatgtctttaaaaatactaaagaagtgtttgtgttcatactcctagcttactagaactcttggagagcattacttaaagggaagagatcaagaatat |
120 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22042591 |
atttatatcttcaaaaacactaaagaagtgtttgtgttcatgctcctagcttactagaactcttggagagcattacttaaagggaagagatcaagaatat |
22042690 |
T |
 |
| Q |
121 |
ggctgagatggtatcgttataaccaaaatgagtataat |
158 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22042691 |
ggctgagatggtatcgttataaccgaaatgagtataat |
22042728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University