View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_4 (Length: 618)
Name: NF1324_low_4
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 48868427 - 48868490
Alignment:
| Q |
33 |
taagcaacgcaagaataattgaaatgattgtaggtgacaaatggtcaccgtggtctacgttata |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48868427 |
taagcaacacaagaataattgaaatgattgtaggtgacaaatggtcaccgtggtctacgttata |
48868490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 486 - 522
Target Start/End: Original strand, 48882026 - 48882062
Alignment:
| Q |
486 |
atggttcaattggttgttgatcttcagctaaatgaat |
522 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48882026 |
atggttcaattagttgttgatcttcagctaaatgaat |
48882062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University