View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_42 (Length: 226)
Name: NF1324_low_42
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 23622352 - 23622573
Alignment:
| Q |
1 |
cttgcaggttttgtagaagtcttttgtcttctttttcagtttagttaagtacatattctttctgagattgagagttttacctacaattatcatatttatt |
100 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23622352 |
cttgcaagttttgtagaagtcttttttcttctttttcagtttagttaagtacatattctttctgagattgagagttttacctacaattatcatatttatt |
23622451 |
T |
|
| Q |
101 |
tcgtccatgaccatgtctcctttgaagtttaagaaattgtcatttttactaataattacaaaagttaactctgctaccaagtgttaaattataccttatt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23622452 |
tcgtccatgaccatgtctcatttgaagtttaagaaattgtcatttttactaataattacaaaagttaactctgctaccaagtgttaaattataccttatt |
23622551 |
T |
|
| Q |
201 |
cccttcaaaataaggagaaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23622552 |
cccttcaaaataaggagaaaaa |
23622573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University