View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1324_low_5 (Length: 471)
Name: NF1324_low_5
Description: NF1324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1324_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 164 - 327
Target Start/End: Original strand, 34479351 - 34479514
Alignment:
| Q |
164 |
aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaatggcacgtgtgaagaactttaaggatan |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
34479351 |
aatatttggtaggtttggactataaataagatgcatgcaggattggtgatgaatctgtgtgcagagcaacaattgcacgtgtgaagaattttaaggattt |
34479450 |
T |
|
| Q |
264 |
nnnnnngttaaagtaaaatatattaataaccacattcttgcacaatataaagagagatcaataa |
327 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
34479451 |
ttttttgttaaagtaaaatgtattaataaccacattcttgcataatataaacagagatcaataa |
34479514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University