View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13251_low_6 (Length: 296)
Name: NF13251_low_6
Description: NF13251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13251_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 10 - 279
Target Start/End: Original strand, 28201319 - 28201588
Alignment:
| Q |
10 |
aagaatatgagccaaaaattgtcatgataatgctaaaatgattagcatatgaaggccaacatagccaagctctgaaggataaatagtaacctaatatgcc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28201319 |
aagaaaatgagccaaaaattgtcatgataatgctaaaatgattagcatatgaaggccaacatatccaagctctgaaggataaatagtaacctaatatgcc |
28201418 |
T |
 |
| Q |
110 |
aaacaagcaaacttttgtggtcaaagggtgaacttggaatggggaaattgtgttattacctgcagtttgaacttgaaggaatcctaatagtgtgggaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28201419 |
aaacaagcaaacttttgtggtcaaagggtgaacttggaatggggaaattgtgttattacctgcagtttgaacttgaaggaatcctaatagtgtgggaaat |
28201518 |
T |
 |
| Q |
210 |
gtaaatgcatagattttatgccggtgggttgtgaaggaataatgagtttggttacatgcaatcgagatag |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28201519 |
gtaaatgcatagattttatgccggtgggttgtgaaggaataatgagtttggttacatgcaatcgagatag |
28201588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University