View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13251_low_7 (Length: 227)
Name: NF13251_low_7
Description: NF13251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13251_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 35095413 - 35095614
Alignment:
| Q |
1 |
cctaaattacaactaaaataaggattaatgtgaaggctgaattctcaaacaaatgctgttatttacgttaaaagtcctcactttaaaggagctggatgga |
100 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095413 |
cctaaactacagctaaaataaggattaatgtgaaggctgaattctcaaacaaatgctgttatttacgttaaaagtcctcactttaaaggagctggatgga |
35095512 |
T |
 |
| Q |
101 |
ctctaaaaaataaatacttttgtgttaacaaaagacatcaatg--nnnnnnnnnaaatccaataattttgattcagttgctataaatgtcttttcaccct |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095513 |
ctctaaaaaagaaatacttttgtgttaacaaaagacatcaatgtttttttttttaaatccaataattttgattcagttgctataaatgtcttttcaccct |
35095612 |
T |
 |
| Q |
199 |
ta |
200 |
Q |
| |
|
|| |
|
|
| T |
35095613 |
ta |
35095614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University