View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13252_low_9 (Length: 211)

Name: NF13252_low_9
Description: NF13252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13252_low_9
NF13252_low_9
[»] chr8 (1 HSPs)
chr8 (107-201)||(9656734-9656827)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 107 - 201
Target Start/End: Original strand, 9656734 - 9656827
Alignment:
107 ctatgatattttacttctaaggagtaacacaaatcattgttaaaatttcaaacgatttttaagcattagtaatttaggattagaccctatgctac 201  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||    
9656734 ctatgatattttacttctaaggagtaacacaaattattgttaaaatttcaaacgatttttaagcattagtaatttagga-tagaccctaggctac 9656827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University