View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13252_low_9 (Length: 211)
Name: NF13252_low_9
Description: NF13252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13252_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 107 - 201
Target Start/End: Original strand, 9656734 - 9656827
Alignment:
| Q |
107 |
ctatgatattttacttctaaggagtaacacaaatcattgttaaaatttcaaacgatttttaagcattagtaatttaggattagaccctatgctac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9656734 |
ctatgatattttacttctaaggagtaacacaaattattgttaaaatttcaaacgatttttaagcattagtaatttagga-tagaccctaggctac |
9656827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University