View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_30 (Length: 294)
Name: NF13253_high_30
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 62704 - 62970
Alignment:
| Q |
1 |
tccgagattgaactaaatctaggatttgttaacataaatgagcagatctaaacacatcgtaatatgggatgattaatgcattttcttttgtcacagttag |
100 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||| ||||||| | |||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62704 |
tccgagattgaactacatctaggttttggtaacataaatgagaagatctacaaacataggaatatgggatgattaatgcattttcttttgtcacagttag |
62803 |
T |
 |
| Q |
101 |
atgtaaatgcctttacttttgacttcatggtagaaacttctttattcactacaaagagaggtatgaatatgaataattacatgcagaatatcgtgtgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
62804 |
atgtaaatgcctttacttttgact---tggtagaaacttctttattcactacaaagagaggt----atatgaataattacatgcagaatatcgtgtgctt |
62896 |
T |
 |
| Q |
201 |
tatcataagtacttgtataaaaatattgtataaccaaatagagaatataattcaaattc--ttatatatacgtttt |
274 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
62897 |
tatcataagtacttg--taaaaatattgtataaccaaatagagaatataattcaaattcttttatatatacgtttt |
62970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University