View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_31 (Length: 291)
Name: NF13253_high_31
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 48106541 - 48106823
Alignment:
| Q |
1 |
ccgtcgatctaaccgtagcctctgctgttgctgctgtttctggacaatcctcaccgttctcgccgccgcatttctcgtcgcgattgtcggtgctgtattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48106541 |
ccgtcgatctaaccgtagcctctgctgttgctgctgtttctggacaatcctcaccgttctcgccgccgcatttctcgtcgcgattgtcggtgctgtattc |
48106640 |
T |
 |
| Q |
101 |
tatgtactctaccatcctcaccaaccacaattctccatcactaacctccgcattgccaagatgaatctcaaaactccaactgattcaccttcacatctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48106641 |
tatgtactctaccatcctcaccaaccacaattctccatcactaacctccgcattgccaagatgaatctcaaaactccagctgattcaccttcacatctca |
48106740 |
T |
 |
| Q |
201 |
ctacactcttcaacctcacactcatcgctaaaaaccctaacaatcaccttgttttcttctacgagcctttcactgtctctgct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48106741 |
ctacactcttcaacctcacactcatcgctaaaaaccctaacaatcaccttgttttcttctacgagcctttcactgtcactgct |
48106823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 59 - 97
Target Start/End: Complemental strand, 7355507 - 7355469
Alignment:
| Q |
59 |
ctcgccgccgcatttctcgtcgcgattgtcggtgctgta |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7355507 |
ctcgccgctgcatttctcgtcgcgattgtcggtgttgta |
7355469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University