View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_33 (Length: 279)
Name: NF13253_high_33
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 45 - 230
Target Start/End: Complemental strand, 16801090 - 16800909
Alignment:
| Q |
45 |
taaaaaactagagccaacttattaatggagagggagaatctttttaattgagaaaccatgatgttttctattaatatgtaaatatgttatcatctcatag |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16801090 |
taaaaaactagagccaacttattaatggagagggagaatctttt-aattgagaaaccatgatgttttctattaatatgtaaatatgttatcatctcatag |
16800992 |
T |
 |
| Q |
145 |
gtgcattattcctagcattaag-caacaatccagcatacaacactattatttatcttttggttaattagtgacctttatttatctgg |
230 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16800991 |
gtgcattattcctaacattaagacaacaattcagcatacaacactattatttatcttttgg----ttagtgacctttatttatctgg |
16800909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University