View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_38 (Length: 256)
Name: NF13253_high_38
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 47447888 - 47447664
Alignment:
| Q |
13 |
agcagagaagaaattttgtacaattatgaaggtagaaggagaaatttggtgaaagacaaatgcaaatggatgaatctgttgcatttataaaggtatagga |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47447888 |
agcagaaaagaaattttgtacaattatgaaggtagaaggagaaatttggtgaaagacaaatgcaaatggatgaatctgttgcatttataaaggtataggt |
47447789 |
T |
 |
| Q |
113 |
gagaattgttaattccattactaatgtgtattgtgtactatatatttgattggtacttacattggaacaatgtttgttgtggcagggacttgaaaacctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47447788 |
gagaattgttaattccattactaatgtgtattgtgtactatatatttgattggtacttacattggaacaatgtttgttgtggcagggacttgaaaacttg |
47447689 |
T |
 |
| Q |
213 |
tgagttcaataacgatgatgccatt |
237 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
47447688 |
tgagttcactaacgatgatgccatt |
47447664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University