View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_39 (Length: 250)
Name: NF13253_high_39
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 36 - 237
Target Start/End: Original strand, 48798488 - 48798689
Alignment:
| Q |
36 |
tgccagttaggctttgcaagaaaagctatgatgctagttaggcttcggggaaggtggaactaaagtattgttgaaataagattctagttaggaagctaag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48798488 |
tgccagttaggctttgcaagaaaagctatgatgctagttaggcttcggggaaggtggaactaaagtattgttgaaataagattctagttaggaagctaag |
48798587 |
T |
 |
| Q |
136 |
tattgtttgacttgtctatagtgatccggagcaatcataaaaggaagttagcatgcaaagcaatgccagtttcgataagatgtgagcaaaacaccaagga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48798588 |
tattgtttgacttgtctatagtgatccggagcaatcataaaaggaagttagcatgcaaagcaatgccagtttcgataagatgtgagcaaaacaccaagga |
48798687 |
T |
 |
| Q |
236 |
tg |
237 |
Q |
| |
|
|| |
|
|
| T |
48798688 |
tg |
48798689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University