View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_high_45 (Length: 234)
Name: NF13253_high_45
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 9358378 - 9358171
Alignment:
| Q |
18 |
ataatggaagactaattaataccttgcttgattatagtatttcagacgggataagcaattcactaacttcaactttctttggtttactctcatggccact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9358378 |
ataatggaagactaattaataccttgcttgattatagtatttctgacgggataagcaattcactaacttcaattttctttggtttactctcatggccact |
9358279 |
T |
|
| Q |
118 |
ttaagtcttctttttctaattctgcacactgatagactaacatcctttacatcttcaggttcttccaaatccaatacaatatggtcattacacgcattca |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| || |
|
|
| T |
9358278 |
ctaagtcttctttttctaattctgcatactgatagactaacatcctttacatcttcaggttcttccaaatccaagacaatatggtcattacatgcatcca |
9358179 |
T |
|
| Q |
218 |
tctcactc |
225 |
Q |
| |
|
| |||||| |
|
|
| T |
9358178 |
tgtcactc |
9358171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University