View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13253_low_20 (Length: 350)
Name: NF13253_low_20
Description: NF13253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13253_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 45346492 - 45346711
Alignment:
| Q |
17 |
catacatacttcaaataccaggcaatttcaacatcaaagctactggtttttaacatcaattttaatgctctttgttatggttcacatgcttttaaggtta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346492 |
catacatacttcaaataccaggcaatttcaacatcaaagctactggtttttaacatcaattttaatgctctttgttatggttcacatgcttttaaggtta |
45346591 |
T |
|
| Q |
117 |
aatcttacatggtaagccccaaatgaatcttttgatatataataactcgtcattgcacgacgcaaacacaatgttttattccaaaagactagtttgtaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346592 |
aatcttacatggtaagccccaaatgaatcttttgatatataataacttgtcattgcacgacgcaaacacaatgttttattccaaaagactagtttgtaac |
45346691 |
T |
|
| Q |
217 |
tataacattattattggttt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45346692 |
tataacattattattggttt |
45346711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 307
Target Start/End: Original strand, 45346711 - 45346741
Alignment:
| Q |
277 |
taggaaaagcaatgtcacggaatatgtaccc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45346711 |
taggaaaagcaatgtcacggaatatgtaccc |
45346741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 254 - 307
Target Start/End: Complemental strand, 32355628 - 32355575
Alignment:
| Q |
254 |
gcaaacatgaatcgttctaaaaataggaaaagcaatgtcacggaatatgtaccc |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
32355628 |
gcaaacatgaatcgttctacaaataggaaaagcaatgtcacccaatatgtaccc |
32355575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University