View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_103 (Length: 250)
Name: NF13254_high_103
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_103 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 22885922 - 22885711
Alignment:
| Q |
1 |
tcttgtcgaaccgtgcttttattttacaattttgtttataatatttctggtggagtagcattatgttttttctgtcacaaatttccagtgtcagtttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
22885922 |
tcttgtcgaaccgtgcttttattttacaattttgtttataatatttctggtggagtagcattatgttttttctgtcacaaatttctagtgtcagttttgg |
22885823 |
T |
|
| Q |
101 |
aactgcaaatttactttattgtcatatgaataatgatgata------------atgatataaatatgttaatttggttggtttatcatattcgattcgag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22885822 |
aactgcaaatttactttattgtcatatgaataatgatgatatgaatgatgatgatgatataaatattttaatttggttggtttatcatattcgattcgag |
22885723 |
T |
|
| Q |
189 |
gcatgttcttag |
200 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22885722 |
gcatgttcttag |
22885711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University