View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_120 (Length: 226)
Name: NF13254_high_120
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_120 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 39944707 - 39944473
Alignment:
| Q |
1 |
tagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtgtggtgatggtgattgtggatgttgaggctcattggttggtgaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944707 |
tagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtgtggtgatggtgattgtggatgttgaggctcattggttggtgaggga |
39944608 |
T |
 |
| Q |
101 |
ttgtgagatggtggttgtgagggactgttgggtggtgaatgaattgttagttgtagaggatgactaatcggtgattg---------tacttgaggatcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39944607 |
ttgtgagatggtggttgtgagggactgttgggtggtgaatgatttgttagttgtagaggatgactaatcggtgattgtactagttgtacttgaggatcat |
39944508 |
T |
 |
| Q |
192 |
ttattggtgaagattgtggtggttgtggagggtca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944507 |
ttattggtgaagattgtggtggttgtggagggtca |
39944473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University