View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_19 (Length: 538)
Name: NF13254_high_19
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 197 - 521
Target Start/End: Complemental strand, 48578052 - 48577728
Alignment:
| Q |
197 |
tggattgagtcctgggtcaaaggtgcaaaacaaaatttcagagttcaatatgcaaaagatatagggtagcatggcatttgcagtttttaatagttcaggg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48578052 |
tggattgagtcctgggtcaaaggtgcaaaacaaaatttcagagttcaatatgcaaaagatatagggtagcatggcatttgcagtttttaatagttcaggg |
48577953 |
T |
 |
| Q |
297 |
tgtgcaagtgcacccctcactaatacatgggtccccctctgcatatcacccaatattagagttgattccaggttagctgatagcactcgaacaagccaac |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48577952 |
tgtgcaagtgcacccctcactaatacatgggtccccctctgcatatcacccaatattagagttgattccaggttagctgatagcactcgaacaagccaac |
48577853 |
T |
 |
| Q |
397 |
ttaaaaaatgggatataataaaggggaaaacatttcaccagtaatcaccacaagagcatatcccactcctaaaatgatggaatcgatttgcatccctcaa |
496 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48577852 |
ttaaaaaatgggatttaataaaggggaaaacatttcaccagtaatcaccacaagagcatatcccactcctaaaatgatggaatcgatttgcatccctcaa |
48577753 |
T |
 |
| Q |
497 |
aactatctctcgctgaaaaacatta |
521 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48577752 |
aactatctctcgctgaaaaacatta |
48577728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 9 - 135
Target Start/End: Complemental strand, 48578235 - 48578109
Alignment:
| Q |
9 |
gaagaatattgggttgcacgcacaagagagagaaggaactgggcggatcgtgtgacagtgagagggaagcagggtgtgtgtcaggtgtggcgcagtggag |
108 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48578235 |
gaagaaaattgggttgcgcgcacaagagagagaaggaactgggcggatcgtgtgacagtgagagggaagcagggtgtgtgtcaggtgtggcgcagtggag |
48578136 |
T |
 |
| Q |
109 |
gtgcttgggaagctgctgccggcaaca |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48578135 |
gtgcttgggaagctgctgccggcaaca |
48578109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University