View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_22 (Length: 518)
Name: NF13254_high_22
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 4e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 354 - 496
Target Start/End: Original strand, 10470124 - 10470266
Alignment:
| Q |
354 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470124 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
10470223 |
T |
 |
| Q |
454 |
ttttctggaactttatgttctttcactattggattggtctgtg |
496 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10470224 |
ttttcaggaactttatgttctttcactgttggattggtctgtg |
10470266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 10470063 - 10470126
Alignment:
| Q |
20 |
ccatttgggagaccagaccatatggttctctagcatctagatagtatggaaaactaaagatgct |
83 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10470063 |
ccatttgggagacccgaccatatggttctctagcatctagatagtatggaaaactagagatgct |
10470126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 98 - 233
Target Start/End: Complemental strand, 10616367 - 10616232
Alignment:
| Q |
98 |
aaaggttttgagttggagaaggttgtggaggaggcaaaagttctatcttagaaaattcttaaaaccataacaagaggaattgtttatgcaagaaataagt |
197 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||| || || | ||||||| |||| | | || |||| | |||||||| | ||||||||| ||| ||| |
|
|
| T |
10616367 |
aaaggttttgattgggagaagattgtggaggagacataaatcctatcttggaaactccatagcaccaaatcaagaggattcatttatgcaatgaatcagt |
10616268 |
T |
 |
| Q |
198 |
ggcttgagaacaagttgagctgtttggggacagtaa |
233 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
10616267 |
ggcttgaaaaccctttgagctgtttggggatagtaa |
10616232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 89 - 174
Target Start/End: Complemental strand, 30950217 - 30950131
Alignment:
| Q |
89 |
ttttctcataaaggttttgagttggagaaggttgtggaggag-gcaaaagttctatcttagaaaattcttaaaaccataacaagagg |
174 |
Q |
| |
|
|||||||||||||||| ||| | ||| ||||||| ||||||| ||||| ||||||||||| | || |||||||||| | ||||||| |
|
|
| T |
30950217 |
ttttctcataaaggttatgattgggataaggttgcggaggagaccaaaaattctatcttaggagatgcttaaaaccaaatcaagagg |
30950131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University