View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_47 (Length: 403)
Name: NF13254_high_47
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 5 - 356
Target Start/End: Original strand, 8316411 - 8316762
Alignment:
| Q |
5 |
accaagctcgacttagatgatattgatttatcatacaattataatccattgtgttcttattgtgaagaaatttgcactgattattgctatgactatgata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316411 |
accaagctcgacttagatgatattgatttatcatacaattataatccattgtgttcttattgcgaagaaatttgcactgattattgctatgactatgata |
8316510 |
T |
 |
| Q |
105 |
aggttagttttctccctcttgttatcttatttgatagtccaccccaaaacattgatgataaattaagtaactctgatgattttggatgcagtataaattg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316511 |
aggttagttttctccctcttgttatcttatttgatagtccaccccaaaacattgatgataaattaagtaactctgatgattttggatgcagtataaattg |
8316610 |
T |
 |
| Q |
205 |
actgtatgtccaaggtgtcatgtttgcggcaatcataaagccaatttgcgcgatgcagaagtatatgaaaggcgtgtggagatagattttgagagcggga |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316611 |
actgtatgtccaaggtgtcatgtttgcggaaatcataaagccaatttgcgcgatgcagaagtatatgaaaggcgtgtggagatagattttgagagcggga |
8316710 |
T |
 |
| Q |
305 |
tgaaaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcag |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316711 |
tgaaaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcag |
8316762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University