View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_90 (Length: 271)
Name: NF13254_high_90
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 3268251 - 3268505
Alignment:
| Q |
1 |
attgaacctacaagattgttatgagaaagagaaacaaacttagttttatagcagtacctaaacaaagctgaaggtatctccccattgaaaccattctttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3268251 |
attgaacctacaagattgttatgagaaagagaaacaaacttagttttatagcagtacctaaacaaagctgaaggtatctccccattgaagccattctttg |
3268350 |
T |
 |
| Q |
101 |
ataaatctagaaaacgaatattaggcaaatcaccaatgaaatctgggatcgaaccggataacgcattggagctgaaattaatcttccacaatgagtgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268351 |
ataaatctagaaaacgaatattaggcaaatcacccatgaaatctgggatcgaaccggataacgcattggagctgaaattaatcttccacaatgagtgaag |
3268450 |
T |
 |
| Q |
201 |
atcagcataatcatctggaatattacccgaaaatcgattcccaaacaatgtcaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268451 |
atcagcataatcatctggaatattacccgaaaatcgattcccaaacaatgtcaat |
3268505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University