View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_94 (Length: 261)
Name: NF13254_high_94
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 49276546 - 49276784
Alignment:
| Q |
1 |
acttcgttttcaaataccacaatcttgcatgagtaatttaatagcgtgtggtttaagtaatcaacttcagaaacggaacgtgggcatttttgtttcggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49276546 |
acttcgttttcaaataccacaatcttgcatgagtaatttaatagcgtgtggtttaagtcatcaacttcagaaacggaacgtgggcatttttgtttcggag |
49276645 |
T |
|
| Q |
101 |
tgcagattttggtctcttggagttccttagcttcgataagaatcttctcagtcgtgatttgaattggagcatcggttttgttcttctccattgttggtcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49276646 |
tgcagattttggtctcttggagttccttagcttcgataagaatcttctcagttgtgatttgaattggagcatcggttttgttcttctccattgttggtcg |
49276745 |
T |
|
| Q |
201 |
aggaagcttccaccgtgtgtcttctctagggaaataact |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49276746 |
aggaagcttccactgtgtgtcttctctagggaaataact |
49276784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 117 - 205
Target Start/End: Original strand, 49280186 - 49280274
Alignment:
| Q |
117 |
ttggagttccttagcttcgataagaatcttctcagtcgtgatttgaattggagcatcggttttgttcttctccattgttggtcgaggaa |
205 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||| |||||||||||||| |||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
49280186 |
ttggagttccttatcttcgataagaatcagctcagttgtgatttgaattggtgcatcggttttgttgttcaccgttgttggtcgaggaa |
49280274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 70
Target Start/End: Original strand, 49280104 - 49280172
Alignment:
| Q |
2 |
cttcgttttcaaataccacaatcttgcatgagtaatttaatagcgtgtggtttaagtaatcaacttcag |
70 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49280104 |
cttctttttcaaatgccacaatcttgcatgggtaatttaatagcgtgtggttcaagtaatcaacttcag |
49280172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University