View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_high_99 (Length: 254)
Name: NF13254_high_99
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_high_99 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 38 - 244
Target Start/End: Original strand, 31715016 - 31715232
Alignment:
| Q |
38 |
ttagactttgaaatccaatgggcagatgttgttgttgaaaggcggtac----------gcgaaagatggctttggtggacaaacatgtttacttacattc |
127 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31715016 |
ttagactttgaaatccaatgggcagacgttgttgttgaaaggcggtacaaacatgtgtgcgaaagatggctttggtggacaaacatgtttacttacattc |
31715115 |
T |
|
| Q |
128 |
ctccaaaggagttaaataaaacaatgtagagcttctcatgaattcatctgattttcttcatcctttgctctatgttttctacagccattacgatatttac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31715116 |
ctccaaaggagttaaataaaacaatgtagagcttctcatgaaatcatcagattttcttcatcctttgctctatgttttgtacagccattacgatatttac |
31715215 |
T |
|
| Q |
228 |
actattagtattatcta |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31715216 |
actattagtattatcta |
31715232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University