View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_low_105 (Length: 250)

Name: NF13254_low_105
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_low_105
NF13254_low_105
[»] chr1 (1 HSPs)
chr1 (1-200)||(22885711-22885922)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 22885922 - 22885711
Alignment:
1 tcttgtcgaaccgtgcttttattttacaattttgtttataatatttctggtggagtagcattatgttttttctgtcacaaatttccagtgtcagtttttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |    
22885922 tcttgtcgaaccgtgcttttattttacaattttgtttataatatttctggtggagtagcattatgttttttctgtcacaaatttctagtgtcagttttgg 22885823  T
101 aactgcaaatttactttattgtcatatgaataatgatgata------------atgatataaatatgttaatttggttggtttatcatattcgattcgag 188  Q
    |||||||||||||||||||||||||||||||||||||||||            ||||||||||||| |||||||||||||||||||||||||||||||||    
22885822 aactgcaaatttactttattgtcatatgaataatgatgatatgaatgatgatgatgatataaatattttaatttggttggtttatcatattcgattcgag 22885723  T
189 gcatgttcttag 200  Q
    ||||||||||||    
22885722 gcatgttcttag 22885711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University