View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_109 (Length: 248)
Name: NF13254_low_109
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_109 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 29281009 - 29281242
Alignment:
| Q |
1 |
tttttcttgtgtttgttagtttgacactttgtattgttcccttttaggcacatattatgcttaattgggacaannnnnnnnnagggataattgggacaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29281009 |
tttttcttgtgtttgttagtttgacactttgtattgttcccttttaggcacatattatgcttaattgggacaatttttttttagggataattgggacaat |
29281108 |
T |
|
| Q |
101 |
ttctaatacatattgcatttgacttctgnnnnnnnnnnntgttgctaatgttttttcaaacataagaacttttcatgaggtcatcaatcttaatactact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29281109 |
ttctaatacatattgcatttgacttctgaaaaaaaaa--tgttgctaatgttttttcaaacataagaacttttcatgaggtcatcgatcttaatactact |
29281206 |
T |
|
| Q |
201 |
tttgaccaaacacacttaactacggagttatgatga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281207 |
tttgaccaaacacacttaactacggagttatgatga |
29281242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University