View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_111 (Length: 242)
Name: NF13254_low_111
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 33331317 - 33331539
Alignment:
| Q |
18 |
agtatgtcctcctaaattcagattatctcaaattttctatgtcaaacttagatagaacatgtacactattgcaaacttgtgacatgtagtgcatacatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33331317 |
agtatgtcctcctaaattcagattatctcaatttttctatgtcaaacttagatggaacatgtacactattgcaaacttgtgacatgtagtggatacatca |
33331416 |
T |
 |
| Q |
118 |
nnnnnnnnn-------gagggaatgtagtggatacatcatacatagtattatttttatttatgcagtatttttgtatctagaaaacttggatgtagtttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33331417 |
ttttttatttttttttgagggaatgtagtggatacatcatacatagtattacttttatttatgcagtatttttgtatctagaaaacttggatgtagtttt |
33331516 |
T |
 |
| Q |
211 |
ttgtttatagagttgatgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33331517 |
ttgtttatagagttgatgatgtc |
33331539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University