View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_113 (Length: 239)
Name: NF13254_low_113
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_113 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32506320 - 32506545
Alignment:
| Q |
1 |
tgaacatagtccccactttcttgattcacaactatgccttaatgtcaacnnnnnnnnnnn----ctacattccaaaattactctattcccttattagcat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506320 |
tgaacatagtccccactttcttgattcacaactatgccttaatgtcaaaaaaaaaaaaaaaaaactacattccaaaattactctattcccttattagcat |
32506419 |
T |
|
| Q |
97 |
tttccattctttatttatgttgaagaacgtgaactttctatttatattgcctaagagtcagaaccataagataataatgtccctagagtctacacatgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506420 |
tttccattctttatttatgttgaagaacgtgaactttctatttatattgcctaagagtcagaaccataagataataatgtccctagagtctacacatgta |
32506519 |
T |
|
| Q |
197 |
gatgttttttgactctaatctagagg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32506520 |
gatgttttttgactctaatctagagg |
32506545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University