View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_117 (Length: 230)
Name: NF13254_low_117
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 3883289 - 3883478
Alignment:
| Q |
20 |
gaggaagctgttgaagctgctatatatgttgaagactcttgatgttcgcttttgtcctaaggtgagagcaaatacataaattttttgaaatgttgatttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3883289 |
gaggaagctgttgaagctgctatatatgttgaagactcttgatgttcgcttttgtcctaaggtgagagcaaatacataaattttttgaaatgttgatttc |
3883388 |
T |
|
| Q |
120 |
agttaaaatgaaactttatcttgcatgatgcaatgcgtggttgcttgaatgtttgtttttatcatgttcttcaatcatttgtgatattct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3883389 |
agttaaaatgaaactttatcttgcatgatgcaatgcatggttgcttgaatgtttgtttttatcatgttcttcaatcatttgtgatattct |
3883478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 44 - 119
Target Start/End: Original strand, 3869917 - 3869994
Alignment:
| Q |
44 |
tatgttgaagactcttgatgttcgcttttgtcctaaggtgagagcaaatacata-aat-tttttgaaatgttgatttc |
119 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
3869917 |
tatgttggagactcttgatgttcgcttctgtcctaaggtgagagcaaatgcatataatatttttgaaatgttgatttc |
3869994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University