View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_121 (Length: 226)
Name: NF13254_low_121
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_121 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 42343731 - 42343930
Alignment:
| Q |
11 |
ggagcagagaaggagagataaaatattttacttaatctgcatttggtaatattgactcttatgaaacttgcaatagggacttcccaaatggttgggctcc |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42343731 |
ggagcagaaaaggagagataaaatattttacttaatctgcatttggtaatattgactcttatgaaacttgcaatagggacttcccgaatggttgggctcc |
42343830 |
T |
 |
| Q |
111 |
acttcaacacatgttagttgaaggccttgtaaaatcagggttggaagaagcaaggtcgttggctgaagaaattgccataagatggatcacaacaaattat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42343831 |
acttcaacacatgttagttgaaggccttataaaatcagggttggaagaagcaaggtcgttggctgaagaaattgccataagatggatcacaacaaattat |
42343930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University