View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_low_121 (Length: 226)

Name: NF13254_low_121
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_low_121
NF13254_low_121
[»] chr8 (1 HSPs)
chr8 (11-210)||(42343731-42343930)


Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 42343731 - 42343930
Alignment:
11 ggagcagagaaggagagataaaatattttacttaatctgcatttggtaatattgactcttatgaaacttgcaatagggacttcccaaatggttgggctcc 110  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
42343731 ggagcagaaaaggagagataaaatattttacttaatctgcatttggtaatattgactcttatgaaacttgcaatagggacttcccgaatggttgggctcc 42343830  T
111 acttcaacacatgttagttgaaggccttgtaaaatcagggttggaagaagcaaggtcgttggctgaagaaattgccataagatggatcacaacaaattat 210  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42343831 acttcaacacatgttagttgaaggccttataaaatcagggttggaagaagcaaggtcgttggctgaagaaattgccataagatggatcacaacaaattat 42343930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University