View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_123 (Length: 226)
Name: NF13254_low_123
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_123 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 7841845 - 7841620
Alignment:
| Q |
1 |
caaggtggcttcacataaaatgtatgatgaagcaaggaatagaatgaatgtggttggagataagggcaatcatgccaaagataaaatgggatgtggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7841845 |
caaggtggcttcacataaaatgtatgatgaagcaaggaatggaatgaatgtggttggagataagggcaatgatgccaaagataaaatgggatgtggagga |
7841746 |
T |
 |
| Q |
101 |
gacaaagtggacgaaacttttgaccaagctaaacatgaagtgggtgaagcttacatgtcggcaagggattcaacgagtgaagaggccaaggctaaatacg |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7841745 |
gacaaagtggaagaaacttttgaccaagctaaacatgaagtgggtgaagcttacatgtcggcaagggattcaacgagtgaagaggccaaggctaaatacc |
7841646 |
T |
 |
| Q |
201 |
aggctgcaaagaagaaggcttcagaa |
226 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
7841645 |
aggctgcaaaggagaaggcttcagaa |
7841620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University