View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_48 (Length: 402)
Name: NF13254_low_48
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_48 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 11 - 366
Target Start/End: Complemental strand, 447720 - 447364
Alignment:
| Q |
11 |
cagagaagtcaatcgagggagccggttcaacaccctcattcaatggaagaggagtctggccagtaggcaccgcagtatcagtagccggtacctttgtttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447720 |
cagagaagtcaatcgagggagccggttcaacaccctcattcaatggaaggggagtctggccagtaggcaccgcagtatcagtagccggtacctttgtttg |
447621 |
T |
 |
| Q |
111 |
ttgagttattgtatgggatggcaaaatggatgcaagatgctt-gctcagttgtgcattgatcctccttacttctctccgtaatttactaaagctgccaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447620 |
ttgagttattgtatgggatggcaaaatggatgcaagatgctttgctcagttgtgcattgatcctccttacttctctccgtaatttactaaagctgccaac |
447521 |
T |
 |
| Q |
210 |
aagaaatgttagggacctagaaactcctatcagaggttggaacaaaggagaatatgagaggttatttatatgaggagagagaaatggcctctaggaggga |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
447520 |
aagaaatgttagggacctagaaactcctatcagaggttggaactaaggagaatatgagaggttatttctatgaggagagagaaatggcctcaaggaggga |
447421 |
T |
 |
| Q |
310 |
gcaacagattgaggaagatttagccaatgggcaatgggcaagcagacgaagaggata |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447420 |
gcaacagattgaggaagatttagccaatgggcaatgggcaagcagacgaagaggata |
447364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University