View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_60 (Length: 371)
Name: NF13254_low_60
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_60 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 135 - 354
Target Start/End: Original strand, 29329 - 29552
Alignment:
| Q |
135 |
ataccatttggccaagtcaaatcaaatcaaatctagtatatataatttttctcctttcaaatcaaaccttatggtgatataatttttcatgtctcctctt |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
29329 |
ataccatttggccaagtcaa-----atcaaatccagtatatataatttttctcctttcaaatcaaaccttatggtgagataatttttcatgtctccactt |
29423 |
T |
 |
| Q |
235 |
ttcctagtatacctctctagttgccttttgccatggtttgctt---------tgttccaggatgtggtttcttaaacaatgagtctttgttaacatatcc |
325 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29424 |
ttcctagtttacctctctagttgccttttgccatggtttgcttagtttattctgttctaggatgtggtttcttaaacaatgagtctttgttaacatatcc |
29523 |
T |
 |
| Q |
326 |
gcggaatgcgcgggttgggaacaattacg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29524 |
gcggaatgcgcgggttgggaacaattacg |
29552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 277
Target Start/End: Original strand, 11053930 - 11054020
Alignment:
| Q |
188 |
ctttcaaatcaaaccttatggtgatataatttttcatgtctcctcttttcctagtatacct-ctctagttgccttttgccatggtttgctt |
277 |
Q |
| |
|
||||||||| ||| |||||||||| |||||||||||||||||||||| | | || ||||| |||| ||||||||||| |||||| |||| |
|
|
| T |
11053930 |
ctttcaaatgaaatcttatggtgaggtaatttttcatgtctcctctttgcttggtttacctcctctggttgccttttgatatggttcgctt |
11054020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University